Review



paper emdb emd 64384 coordinates  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ATCC paper emdb emd 64384 coordinates
    Paper Emdb Emd 64384 Coordinates, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+emdb+emd+64384+coordinates/Protostropharia+semiglobata+(Batsch)+Redhead+et+al/pm41296570-211-200-221
    Average 90 stars, based on 2 article reviews
    paper emdb emd 64384 coordinates - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Protease Inhibitor:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Magnetic Beads:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Clinical Proteomics:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Membrane:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Real-time Polymerase Chain Reaction:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Cryo-EM Sample Prep:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13

    Sequencing:

    Article Title: Membrane dome-based regulation mechanism of the mechanosensitive PIEZO channel.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-actin mAb ABclonal Cat# AC038; RRID: AB_2863784 Rabbit anti-GAPDH mAb ABclonal Cat# A19056; RRID: AB_2862549 Rabbit anti-Na + /K + ATPase pAb proteintech Cat# 14418-1-AP; RRID: AB_2227873 Rabbit anti-PIEZO1 pAb proteintech Cat# 15939-1-AP; RRID: AB_2231460 Mouse anti-GFP mAb ABclonal Cat# AE012; RRID: AB_2770402 Goat anti-Rabbit IgG (H + L), HRP conjugate ABclonal Cat# AS014; RRID: AB_2769854 Goat anti-Mouse IgG (H + L), HRP conjugate ABclonal Cat# AS003; RRID: AB_2769851 Chemicals, Peptides, and Recombinant Proteins glyco-diosgenin (GDN) Anatrace Cat# GDN101 Polyethylenimine (PEI) YEASEN Cat# 40816ES03 CNBr-activated Sepharose 4B cytiva Cat# 17043001 CHAPS Anatrace Cat# C316 Soy PC Avanti Cat# 441601G protease inhibitor cocktail YEASEN Cat# 20124ES10 GsMTx4 abcam Cat# ab141871 Lipofectamine3000 Thermo Fisher Scientific Cat# L3000015 Sulfo-NHS-LC-Biotin Thermo Fisher Scientific Cat# 21335 streptavidin magnetic beads Thermo Fisher Scientific Cat# 88816 CellMask TM Plasma Membrane Stains Thermo Fisher Scientific Cat# C10045 Critical Commercial Assays The enhanced chemiluminescence kit Biosharp Cat# BL520B TB Green Premix Ex Taq II FAST qPCR TaKaRa Cat# RR830A Deposited data Cryo-EM map of PEZO-1G This paper EMDB: EMD-64385 Coordinates of PEZO-1G This paper PDB: 9UOY The focus-refined density map of PEZO-1G monomer This paper EMDB: EMD-64386 Cryo-EM map of PEZO-1K This paper EMDB: EMD-64384 Coordinates of PEZO-1K This paper PDB: 9UOX Experimental Models: Cell Lines HEK293F Thermo Fisher Scientific Cat# R79007 HEK293T ATCC Cat# CRL-3216 PIEZO1-KO-HEK293T This paper N/A Experimental models: Organisms/strains C.elegans: Wild type N2 Caenorhabditis Genetics Center N2 C.elegans Ppezo-1g::pezo-1g::gfp This paper N/A C.elegans Ppezo-1k::pezo-1k::gfp This paper N/A C.elegans Ppezo-1l::pezo-1l::gfp This paper N/A Oligonucleotides sgRNA targeting sequence for PIEZO1: TGTGCTTCTCCTGCTTGGCA This paper N/A Forward primer for qPCR of act-5: CAACATTCAGGCTGTGCTTT This paper N/A Reverse primer for qPCR of act-5: TGATGGATTGGTAGGTGGTCT This paper N/A (Continued on next page) Cell Reports 44, 116651, December 23, 2025 13



    Similar Products

    paper emdb emd 64384 coordinates  (ATCC)
    90
    ATCC paper emdb emd 64384 coordinates
    Paper Emdb Emd 64384 Coordinates, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+emdb+emd+64384+coordinates/Protostropharia+semiglobata+(Batsch)+Redhead+et+al/pm41296570-211-200-221
    Average 90 stars, based on 1 article reviews
    paper emdb emd 64384 coordinates - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results